Stem-loop sequence rno-mir-187

AccessionMI0000932 (change log)
DescriptionRattus norvegicus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   gg  ucaca    acaa    ga     a    a           c  -  c - ug 
5'   gc     ggac    ugcg  uccuc ggcu caacacaggac cg gg g c  c
     ||     ||||    ||||  ||||| |||| ||||||||||| || || | |   
3'   cg     ucug    acgc  gggag ccga guuguguucug gc cc c g  u
   -a  -----    ---g    -a     g    c           u  u  c a uc 
Get sequence
Deep sequencing
1382 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 16390507-16390610 [-]
intergenic
Database links

Mature sequence rno-miR-187-5p

Accession MIMAT0017144
Previous IDsrno-miR-187*
Sequence

29 - 

aggcuacaacacaggacc

 - 46

Get sequence
Deep sequencing18 reads, 7 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-187-3p

Accession MIMAT0000864
Previous IDsrno-miR-187
Sequence

66 - 

ucgugucuuguguugcagccgg

 - 87

Get sequence
Deep sequencing1364 reads, 34 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).