Stem-loop sequence rno-mir-186

AccessionMI0000931 (change log)
DescriptionRattus norvegicus miR-186 stem-loop
Gene family MIPF0000109; mir-186
Literature search

15 open access papers mention rno-mir-186
(102 sentences)

Stem-loop
   u     c                 u     u      ucucau 
5'  gcuua aacuuuccaaagaauuc ccuuu gggcuu      u
    ||||| ||||||||||||||||| ||||| ||||||       
3'  cgagu uugaaggguuuuuuaag ggaaa cccgaa      u
   u     -                 u     -      uuuuau 
Get sequence
Deep sequencing
2226009 reads, 1.73e+03 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 263873759-263873844 [+]
sense
ENSRNOT00000055259 ; Zranb2-201; intron 8
Database links

Mature sequence rno-miR-186-5p

Accession MIMAT0000863
Previous IDsrno-miR-186
Sequence

15 - 

caaagaauucuccuuuugggcu

 - 36

Get sequence
Deep sequencing2225812 reads, 510 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-186-3p

Accession MIMAT0017143
Previous IDsrno-miR-186*
Sequence

54 - 

gcccaaaggugaauuuuuugg

 - 74

Get sequence
Deep sequencing195 reads, 133 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).