Stem-loop sequence rno-mir-185

Accession

MI0000930

Description

Rattus norvegicus miR-185 stem-loop

Gene family

MIPF0000202; mir-185

Stem-loop

-     u       ug   a     g         au  uc 
 ggggg gagggau  gag gaaag caguuccug  gg  c
 ||||| |||||||  ||| ||||| |||||||||  ||   
 cccuc cuuccug  cuc cuuuc gucggggac  cc  c
a     u       gu   -     g         --  uc 

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (RGSC3.4): 11: 84658785-84658864 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000046594 ; RGD1310348; intron 1

  ENSRNOT00000046594 ; RGD1310348; intron 1

  ENSRNOT00000046594 ; RGD1310348; intron 1

Database links

• ENTREZGENE: 100314243;Mir185

Mature sequence rno-miR-185-5p

• Accession: MIMAT0000862
• Previous IDs: rno-miR-185
• Sequence: 14 - uggagagaaaggcaguuccuga - 35
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Validated targets:
  • TARBASE:rno-miR-185-5p
• Predicted targets:
  • MICRORNA.ORG:rno-miR-185-5p
  • MIRDB:rno-miR-185-5p
  • TARGETSCAN-VERT:rno-miR-185

Mature sequence rno-miR-185-3p

• Accession: MIMAT0017142
• Previous IDs: rno-miR-185*
• Sequence: 58 - uuuccucugguccuucucu - 76
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • MIRDB:rno-miR-185-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).