Stem-loop sequence rno-mir-185

AccessionMI0000930 (change log)
DescriptionRattus norvegicus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Literature search

14 open access papers mention rno-mir-185
(174 sentences)

Stem-loop
   -     u       ug   a     g         au  uc 
5'  ggggg gagggau  gag gaaag caguuccug  gg  c
    ||||| |||||||  ||| ||||| |||||||||  ||   
3'  cccuc cuuccug  cuc cuuuc gucggggac  cc  c
   a     u       gu   -     g         --  uc 
Get sequence
Deep sequencing
48564 reads, 8.59 reads per million, 489 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 86812702-86812781 [+]
sense
ENSRNOT00000046594 ; Tango2-201; intron 1
Database links

Mature sequence rno-miR-185-5p

Accession MIMAT0000862
Previous IDsrno-miR-185
Sequence

14 - 

uggagagaaaggcaguuccuga

 - 35

Get sequence
Deep sequencing42543 reads, 486 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-185-3p

Accession MIMAT0017142
Previous IDsrno-miR-185*
Sequence

58 - 

uuuccucugguccuucucu

 - 76

Get sequence
Deep sequencing5049 reads, 376 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).