Stem-loop sequence rno-mir-184

Accession MI0000929
Description Rattus norvegicus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----     u                ag     -    ug 
    cacuu cccuuaucaguuuucc  ccagc uuug  a
    ||||| ||||||||||||||||  ||||| ||||   
    gugaa gggaauagucaagagg  gguug aaau  c
guca     u                ca     u    gu 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
8: 94692573-94692649 [-]
intergenic
Database links

Mature sequence rno-miR-184

Accession MIMAT0000861
Sequence

47 - 

uggacggagaacugauaagggu

 - 68

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).