Stem-loop sequence rno-mir-183

AccessionMI0000928 (change log)
DescriptionRattus norvegicus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   cca a ag g  a   c  uc    g      --ac     ga        --   ac 
5'    g g  u ug cuc ug  cugu uauggc    uggua  auucacug  uga  a
      | |  | || ||| ||  |||| ||||||    |||||  ||||||||  |||   
3'    c c  a ac gag ac  gaca auaccg    gccau  uaagugac  gcu  g
   -ag g cu g  a   -  ga    a      ggaa     --        ug   cu 
Get sequence
Deep sequencing
46610 reads, 1.02e+03 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 57463569-57463678 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-183
rno-mir-3553chr4: 57463572-57463677 [+]
rno-mir-183chr4: 57463569-57463678 [-]
rno-mir-96chr4: 57463366-57463471 [-]
rno-mir-182chr4: 57459773-57459834 [-]
Database links

Mature sequence rno-miR-183-5p

Accession MIMAT0000860
Previous IDsrno-miR-183
Sequence

27 - 

uauggcacugguagaauucacu

 - 48

Get sequence
Deep sequencing46354 reads, 38 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-183-3p

Accession MIMAT0017141
Previous IDsrno-miR-183*
Sequence

67 - 

ugaauuaccgaagggccauaa

 - 87

Get sequence
Deep sequencing254 reads, 27 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).