Stem-loop sequence rno-mir-181b-1

AccessionMI0000926 (change log)
DescriptionRattus norvegicus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

32 open access papers mention rno-mir-181b-1
(186 sentences)

Stem-loop
   ccugugcagagaugauguuuacaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     guaaguaac   agucacucga   ga g
   -------------------uucgcc       -caac         --a          aaa  u 
Get sequence
Deep sequencing
2828809 reads, 1.88e+03 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 54952903-54953012 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-181b-1
rno-mir-3570chr13: 54952723-54952839 [-]
rno-mir-181a-1chr13: 54952742-54952841 [+]
rno-mir-181b-1chr13: 54952903-54953012 [+]
Database links

Mature sequence rno-miR-181b-5p

Accession MIMAT0000859
Previous IDsrno-miR-181b
Sequence

36 - 

aacauucauugcugucggugggu

 - 58

Get sequence
Deep sequencing5655273 reads, 510 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-181b-1-3p

Accession MIMAT0017139
Previous IDsrno-miR-181b-1*
Sequence

76 - 

cucacugaacaaugaaugcaa

 - 96

Get sequence
Deep sequencing4145 reads, 360 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).