Stem-loop sequence rno-mir-181a-2

AccessionMI0000925 (change log)
Previous IDsrno-mir-181a
DescriptionRattus norvegicus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

61 open access papers mention rno-mir-181a-2
(290 sentences)

Stem-loop
   agaugggcaaccaaggcagccuuaa     cu   u  a   u      cu  c    a    gggauuca 
5'                          gagga  cca gg aca ucaacg  gu ggug guuu        a
                            |||||  ||| || ||| ||||||  || |||| ||||         
3'                          uucuu  ggu cc ugu aguugc  ca ccac caaa        a
   ------------------------a     ag   u  a   c      --  a    -    aaaaacaa 
Get sequence
Deep sequencing
40264780 reads, 2.85e+04 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 23150352-23150468 [+]
antisense
ENSRNOT00000072113 ; Nr6a1-203; intron 1
ENSRNOT00000074794 ; Nr6a1-202; intron 2
Clustered miRNAs
< 10kb from rno-mir-181a-2
rno-mir-181a-2chr3: 23150352-23150468 [+]
rno-mir-181b-2chr3: 23151455-23151542 [+]
Database links

Mature sequence rno-miR-181a-5p

Accession MIMAT0000858
Previous IDsrno-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Deep sequencing80452393 reads, 510 experiments
Evidence experimental; cloned [3-4], SOLiD [4]
Predicted targets

Mature sequence rno-miR-181a-2-3p

Accession MIMAT0017138
Previous IDsrno-miR-181a-2*
Sequence

84 - 

accaccaaccguugacugu

 - 102

Get sequence
Deep sequencing39823 reads, 487 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).