Stem-loop sequence rno-mir-154

AccessionMI0000923 (change log)
DescriptionRattus norvegicus miR-154 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   gc      u            u      ugcc    - uuu 
5'   ggugcu gaagauagguua ccgugu    uucg c   a
     |||||| |||||||||||| ||||||    |||| |   u
3'   ccauga uuuuuauccagu ggcaca    aagc g   u
   aa      c            u      uacu    a ugc 
Get sequence
Deep sequencing
922 reads, 3.85 reads per million, 26 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133888586-133888669 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-154
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
Database links

Mature sequence rno-miR-154-5p

Accession MIMAT0000856
Previous IDsrno-miR-154
Sequence

15 - 

uagguuauccguguugccuucg

 - 36

Get sequence
Deep sequencing895 reads, 26 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-154-3p

Accession MIMAT0017136
Previous IDsrno-miR-154*
Sequence

51 - 

aaucauacacgguugaccuauu

 - 72

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).