Stem-loop sequence rno-mir-153

AccessionMI0000922 (change log)
DescriptionRattus norvegicus miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

20 open access papers mention rno-mir-153
(149 sentences)

Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Deep sequencing
135087 reads, 90.5 reads per million, 367 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 145105064-145105150 [+]
sense
ENSRNOT00000006942 ; Ptprn2-201; intron 19
Database links

Mature sequence rno-miR-153-5p

Accession MIMAT0017135
Previous IDsrno-miR-153*
Sequence

14 - 

gucauuuuugugauguugcagcu

 - 36

Get sequence
Deep sequencing6662 reads, 162 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-153-3p

Accession MIMAT0000855
Previous IDsrno-miR-153
Sequence

53 - 

uugcauagucacaaaagugauc

 - 74

Get sequence
Deep sequencing128424 reads, 362 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).