Stem-loop sequence rno-mir-152

AccessionMI0000921 (change log)
DescriptionRattus norvegicus miR-152 stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ugu   --                 g  a    cc    cgg   c 
5'    ucc  ccgggcccagguucugu au cacu  gacu   gcu u
      |||  ||||||||||||||||| || ||||  ||||   |||  
3'    agg  ggcccggguucaagaca ua guga  cuga   cga g
   --c   au                 g  c    --    ---   g 
Get sequence
Deep sequencing
20238 reads, 79.5 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 84719319-84719403 [+]
sense
ENSRNOT00000055464 ; Copz2-201; intron 1
Database links

Mature sequence rno-miR-152-5p

Accession MIMAT0017134
Previous IDsrno-miR-152*
Sequence

15 - 

agguucugugauacacuccgacu

 - 37

Get sequence
Deep sequencing1157 reads, 35 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-152-3p

Accession MIMAT0000854
Previous IDsrno-miR-152
Sequence

53 - 

ucagugcaugacagaacuugg

 - 73

Get sequence
Deep sequencing19081 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).