Stem-loop sequence rno-mir-152

AccessionMI0000921 (change log)
DescriptionRattus norvegicus miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

19 open access papers mention rno-mir-152
(120 sentences)

Stem-loop
   ugu   --                 g  a    cc    cgg   c 
5'    ucc  ccgggcccagguucugu au cacu  gacu   gcu u
      |||  ||||||||||||||||| || ||||  ||||   |||  
3'    agg  ggcccggguucaagaca ua guga  cuga   cga g
   --c   au                 g  c    --    ---   g 
Get sequence
Deep sequencing
205352 reads, 74.7 reads per million, 495 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 84719319-84719403 [+]
sense
ENSRNOT00000055464 ; Copz2-201; intron 1
Database links

Mature sequence rno-miR-152-5p

Accession MIMAT0017134
Previous IDsrno-miR-152*
Sequence

15 - 

agguucugugauacacuccgacu

 - 37

Get sequence
Deep sequencing14092 reads, 471 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-152-3p

Accession MIMAT0000854
Previous IDsrno-miR-152
Sequence

53 - 

ucagugcaugacagaacuugg

 - 73

Get sequence
Deep sequencing191258 reads, 493 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).