Stem-loop sequence rno-mir-150

AccessionMI0000920 (change log)
DescriptionRattus norvegicus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c        g            ac   u       u -   u 
5'  uucucaag cccugucuccca  ccu guaccag g cug g
    |||||||| ||||||||||||  ||| ||||||| | ||| c
3'  agggguuc gggacagggggu  gga caugguc c gac c
   c        a            cc   -       c a   u 
Get sequence
Deep sequencing
59601 reads, 423 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 101115974-101116058 [+]
intergenic
Database links

Mature sequence rno-miR-150-5p

Accession MIMAT0000853
Previous IDsrno-miR-150
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Deep sequencing59323 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-150-3p

Accession MIMAT0017133
Previous IDsrno-miR-150*
Sequence

52 - 

cugguacaggccuggggga

 - 70

Get sequence
Deep sequencing278 reads, 25 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).