Stem-loop sequence rno-mir-146a

AccessionMI0000919 (change log)
Previous IDsrno-mir-146
DescriptionRattus norvegicus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---------ugug     u     cu            c        --   g 
5'              uaucc cagcu  gagaacugaauu cauggguu  aua c
                ||||| |||||  |||||||||||| ||||||||  |||  
3'              auagg gucga  uucuugacuuga guguccag  ugu a
   uacugcuaucucg     -     -u            a        ac   a 
Get sequence
Deep sequencing
24312 reads, 142 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 28962476-28962570 [-]
intergenic
Database links

Mature sequence rno-miR-146a-5p

Accession MIMAT0000852
Previous IDsrno-miR-146;rno-miR-146a
Sequence

17 - 

ugagaacugaauuccauggguu

 - 38

Get sequence
Deep sequencing24286 reads, 38 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-146a-3p

Accession MIMAT0017132
Previous IDsrno-miR-146a*
Sequence

52 - 

accugugaaguucaguucuuu

 - 72

Get sequence
Deep sequencing26 reads, 13 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).