Stem-loop sequence rno-mir-146a

AccessionMI0000919 (change log)
Previous IDsrno-mir-146
DescriptionRattus norvegicus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

107 open access papers mention rno-mir-146a
(1154 sentences)

Stem-loop
   ---------ugug     u     cu            c        --   g 
5'              uaucc cagcu  gagaacugaauu cauggguu  aua c
                ||||| |||||  |||||||||||| ||||||||  |||  
3'              auagg gucga  uucuugacuuga guguccag  ugu a
   uacugcuaucucg     -     -u            a        ac   a 
Get sequence
Deep sequencing
325824 reads, 226 reads per million, 499 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 28962476-28962570 [-]
intergenic
Database links

Mature sequence rno-miR-146a-5p

Accession MIMAT0000852
Previous IDsrno-miR-146;rno-miR-146a
Sequence

17 - 

ugagaacugaauuccauggguu

 - 38

Get sequence
Deep sequencing325298 reads, 499 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-146a-3p

Accession MIMAT0017132
Previous IDsrno-miR-146a*
Sequence

52 - 

accugugaaguucaguucuuu

 - 72

Get sequence
Deep sequencing522 reads, 208 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).