Stem-loop sequence rno-mir-145

AccessionMI0000918 (change log)
DescriptionRattus norvegicus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

80 open access papers mention rno-mir-145
(703 sentences)

Stem-loop
   ca  u  u     c  uc    u  c            uggau 
5'   cc ug ccuca gg  cagu uu ccaggaaucccu     g
     || || ||||| ||  |||| || ||||||||||||     c
3'   gg ac ggagu uc  guca aa gguccuuagggg     u
   uc  u  u     -  uu    u  a            uagaa 
Get sequence
Deep sequencing
1201260 reads, 740 reads per million, 485 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 56969907-56969994 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-145
rno-mir-143chr18: 56971273-56971377 [-]
rno-mir-145chr18: 56969907-56969994 [-]
Database links

Mature sequence rno-miR-145-5p

Accession MIMAT0000851
Previous IDsrno-miR-145
Sequence

16 - 

guccaguuuucccaggaaucccu

 - 38

Get sequence
Deep sequencing868093 reads, 485 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-145-3p

Accession MIMAT0017131
Previous IDsrno-miR-145*
Sequence

54 - 

ggauuccuggaaauacuguuc

 - 74

Get sequence
Deep sequencing332540 reads, 480 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).