Stem-loop sequence rno-mir-144

AccessionMI0000917 (change log)
DescriptionRattus norvegicus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   --   u      g        a         -a    gu 
5'  ggg  ccu ggcugg auaucauc uauacugua  guuu  g
    |||  ||| |||||| |||||||| |||||||||  ||||   
3'  ccc  ggg cugauc uguaguag auaugacau  caga  a
   c   au   u      a        -         ca    gu 
Get sequence
Deep sequencing
39183 reads, 144 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 65291365-65291447 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-144
rno-mir-144chr10: 65291365-65291447 [-]
rno-mir-451chr10: 65291204-65291275 [-]
Database links

Mature sequence rno-miR-144-5p

Accession MIMAT0017130
Previous IDsrno-miR-144*
Sequence

13 - 

ggauaucaucauauacuguaagu

 - 35

Get sequence
Deep sequencing30767 reads, 37 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-144-3p

Accession MIMAT0000850
Previous IDsrno-miR-144
Sequence

50 - 

uacaguauagaugauguacu

 - 69

Get sequence
Deep sequencing8415 reads, 38 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).