Stem-loop sequence rno-mir-144

AccessionMI0000917 (change log)
DescriptionRattus norvegicus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

31 open access papers mention rno-mir-144
(251 sentences)

Stem-loop
   -   --   u      g        a         -a    gu 
5'  ggg  ccu ggcugg auaucauc uauacugua  guuu  g
    |||  ||| |||||| |||||||| |||||||||  ||||   
3'  ccc  ggg cugauc uguaguag auaugacau  caga  a
   c   au   u      a        -         ca    gu 
Get sequence
Deep sequencing
130450 reads, 59.5 reads per million, 482 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 65291365-65291447 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-144
rno-mir-144chr10: 65291365-65291447 [-]
rno-mir-451chr10: 65291204-65291275 [-]
Database links

Mature sequence rno-miR-144-5p

Accession MIMAT0017130
Previous IDsrno-miR-144*
Sequence

13 - 

ggauaucaucauauacuguaagu

 - 35

Get sequence
Deep sequencing92429 reads, 465 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-144-3p

Accession MIMAT0000850
Previous IDsrno-miR-144
Sequence

50 - 

uacaguauagaugauguacu

 - 69

Get sequence
Deep sequencing38019 reads, 464 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).