Stem-loop sequence rno-mir-143

AccessionMI0000916 (change log)
DescriptionRattus norvegicus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

53 open access papers mention rno-mir-143
(404 sentences)

Stem-loop
   ---        c  g      ag      g         g      u  -  ag 
5'    gcggagcg cu ucuccc  ccugag ugcagugcu caucuc gg uc  u
      |||||||| || ||||||  |||||| ||||||||| |||||| || ||   
3'    cgucuugu ga agaggg  ggacuc augucacga guagag cu ag  u
   cga        a  -      aa      g         a      u  g  gg 
Get sequence
Deep sequencing
197612816 reads, 1.32e+05 reads per million, 504 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 56971273-56971377 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-143
rno-mir-143chr18: 56971273-56971377 [-]
rno-mir-145chr18: 56969907-56969994 [-]
Database links

Mature sequence rno-miR-143-5p

Accession MIMAT0017129
Previous IDsrno-miR-143*
Sequence

26 - 

ggugcagugcugcaucucugg

 - 46

Get sequence
Deep sequencing36862 reads, 463 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-143-3p

Accession MIMAT0000849
Previous IDsrno-miR-143
Sequence

60 - 

ugagaugaagcacuguagcuca

 - 81

Get sequence
Deep sequencing197575912 reads, 504 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).