Stem-loop sequence rno-mir-141

AccessionMI0000914 (change log)
DescriptionRattus norvegicus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -         u a u       --    u          au    gaa 
5'  ggcugacuc g g ccaucuu  ccag gcaguguugg  gguu   g
    ||||||||| | | |||||||  |||| ||||||||||  ||||   u
3'  uugacuggg c c gguagaa  gguc ugucacaauc  ucga   a
   c         c c c       au    -          -c    agc 
Get sequence
Deep sequencing
188336 reads, 2.4e+03 reads per million, 37 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 157236346-157236439 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-141
rno-mir-200cchr4: 157236786-157236854 [-]
rno-mir-3575chr4: 157236759-157236873 [+]
rno-mir-141chr4: 157236346-157236439 [-]
Database links

Mature sequence rno-miR-141-5p

Accession MIMAT0017128
Previous IDsrno-miR-141*
Sequence

14 - 

uccaucuuccagugcaguguug

 - 35

Get sequence
Deep sequencing1755 reads, 24 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-141-3p

Accession MIMAT0000846
Previous IDsrno-miR-141
Sequence

58 - 

uaacacugucugguaaagaugg

 - 79

Get sequence
Deep sequencing186578 reads, 37 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).