Stem-loop sequence rno-mir-139

AccessionMI0000913 (change log)
DescriptionRattus norvegicus miR-139 stem-loop
Gene family MIPF0000117; mir-139
Literature search

21 open access papers mention rno-mir-139
(335 sentences)

Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
125150 reads, 47 reads per million, 483 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 166589545-166589612 [+]
sense
ENSRNOT00000026586 ; Pde2a-201; intron 2
Database links

Mature sequence rno-miR-139-5p

Accession MIMAT0000845
Previous IDsrno-miR-139
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Deep sequencing122338 reads, 483 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-139-3p

Accession MIMAT0004735
Sequence

43 - 

uggagacgcggcccuguuggag

 - 64

Get sequence
Deep sequencing2802 reads, 305 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).