Stem-loop sequence rno-mir-138-1

AccessionMI0000912 (change log)
DescriptionRattus norvegicus miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu   g  ug    u       ag             uca       gc a 
5'   cug ca  gugu gugggac  cugguguugugaa   ggccguu  c a
     ||| ||  |||| |||||||  |||||||||||||   |||||||  | u
3'   gac gu  cacg cacucug  gaccacaacacuu   ucggcaa  g c
   -g   -  --    u       -g             -ca       ga a 
Get sequence
Deep sequencing
79795 reads, 856 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 131731726-131731824 [+]
intergenic
Database links

Mature sequence rno-miR-138-5p

Accession MIMAT0000844
Previous IDsrno-miR-138
Sequence

23 - 

agcugguguugugaaucaggccg

 - 45

Get sequence
Deep sequencing158626 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

Mature sequence rno-miR-138-1-3p

Accession MIMAT0004734
Previous IDsrno-miR-138*;rno-miR-138-1*
Sequence

61 - 

cggcuacuucacaacaccaggg

 - 82

Get sequence
Deep sequencing337 reads, 18 experiments
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).