Stem-loop sequence rno-mir-138-2

AccessionMI0000911 (change log)
DescriptionRattus norvegicus miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Literature search

41 open access papers mention rno-mir-138-2
(176 sentences)

Stem-loop
   gu   u  ag             uca     ---ac   caa 
5'   ugc gc  cugguguugugaa   ggccg     gag   c
     ||| ||  |||||||||||||   |||||     |||   g
3'   acg ug  gaccacagcacuu   ucggc     cuc   c
   cc   u  -g             -ua     ccauu   cua 
Get sequence
Deep sequencing
1608630 reads, 1.17e+03 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 11149748-11149829 [-]
intergenic
Database links

Mature sequence rno-miR-138-5p

Accession MIMAT0000844
Previous IDsrno-miR-138
Sequence

9 - 

agcugguguugugaaucaggccg

 - 31

Get sequence
Deep sequencing3216645 reads, 493 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

Mature sequence rno-miR-138-2-3p

Accession MIMAT0017127
Previous IDsrno-miR-138-2*
Sequence

56 - 

gcuauuucacgacaccagggu

 - 76

Get sequence
Deep sequencing1998 reads, 154 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).