Stem-loop sequence rno-mir-137

AccessionMI0000910 (change log)
DescriptionRattus norvegicus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

20 open access papers mention rno-mir-137
(83 sentences)

Stem-loop
   g   -  cug           ug   g           ug a     -  g 
5'  gcc cu   acucucuucgg  acg guauucuuggg  g uaaua cg a
    ||| ||   |||||||||||  ||| |||||||||||  | ||||| || u
3'  cgg ga   ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a   c  cca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
53773 reads, 60.3 reads per million, 267 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 221658106-221658207 [+]
intergenic
Database links

Mature sequence rno-miR-137-5p

Accession MIMAT0017126
Previous IDsrno-miR-137*
Sequence

23 - 

acggguauucuuggguggauaa

 - 44

Get sequence
Deep sequencing464 reads, 83 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-137-3p

Accession MIMAT0000843
Previous IDsrno-miR-137
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing53287 reads, 267 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).