Stem-loop sequence rno-mir-137

AccessionMI0000910 (change log)
DescriptionRattus norvegicus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. Recent genome-wide association studies (GWAS) have provided evidence to suggest that single nucleotide polymorphisms in the vicinity of the MIR137 gene are statistically associated with schizophrenia and other psychiatric disorders. miR-137 is shown to regulate neural stem cell proliferation and differentiation in mouse embryonic stem cells, and neuronal maturation, including regulation of dendrite length, branch points, end points, and spine density in mouse adult hippocampal neuroprogenitor-derived and mouse fetal hippocampus neurons. Decreased spine density has also been observed in the dorsolateral cortex of patients with schizophrenia. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g   -  cug           ug   g           ug a     -  g 
5'  gcc cu   acucucuucgg  acg guauucuuggg  g uaaua cg a
    ||| ||   |||||||||||  ||| |||||||||||  | ||||| || u
3'  cgg ga   ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a   c  cca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
1321 reads, 5 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 221658106-221658207 [+]
intergenic
Database links

Mature sequence rno-miR-137-5p

Accession MIMAT0017126
Previous IDsrno-miR-137*
Sequence

23 - 

acggguauucuuggguggauaa

 - 44

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-137-3p

Accession MIMAT0000843
Previous IDsrno-miR-137
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing1310 reads, 20 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).