Stem-loop sequence rno-mir-137

Accession MI0000910
Description Rattus norvegicus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. miR-137 has also been shown to regulate dendritic development and maturation of neurons. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g   -  cug           ug   g           ug a     -  g 
 gcc cu   acucucuucgg  acg guauucuuggg  g uaaua cg a
 ||| ||   |||||||||||  ||| |||||||||||  | ||||| || u
 cgg ga   ugagaggagcu  ugc cauaagaauuc  u auugu gc u
a   c  cca           ga   g           gu -     u  a 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
2: 214802296-214802397 [+]
intergenic
Database links

Mature sequence rno-miR-137-5p

Accession MIMAT0017126
Previous IDs rno-miR-137*
Sequence

23 - 

acggguauucuuggguggauaa

 - 44

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-137-3p

Accession MIMAT0000843
Previous IDs rno-miR-137
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).