Stem-loop sequence rno-mir-136

AccessionMI0000909 (change log)
DescriptionRattus norvegicus miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
   u        g        c     uuu          uuc 
5'  gagcccuc gaggacuc auuug   ugaugaugga   u
    |||||||| |||||||| |||||   ||||||||||   u
3'  cuugggag cuucugag uaaac   gcuacuaccu   a
   u        a        -     ucu          cga 
Get sequence
Deep sequencing
45675 reads, 282 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133716761-133716842 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-136
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-136-5p

Accession MIMAT0000842
Previous IDsrno-miR-136
Sequence

15 - 

acuccauuuguuuugaugaugga

 - 37

Get sequence
Deep sequencing10102 reads, 35 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-136-3p

Accession MIMAT0004733
Previous IDsrno-miR-136*
Sequence

49 - 

caucaucgucucaaaugagucu

 - 70

Get sequence
Deep sequencing35573 reads, 38 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).