Stem-loop sequence rno-mir-135a

AccessionMI0000908 (change log)
DescriptionRattus norvegicus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a  uaaa     ucua   c            u            -u gua 
5'  ga    uucac    gug uuuauggcuuuu auuccuauguga  c   a
    ||    |||||    ||| |||||||||||| ||||||||||||  |    
3'  cu    aagug    cau aaguaccgaagg uagggauguacu  g   u
   a  -uaa     -uua   a            -            cu aaa 
Get sequence
Deep sequencing
4136 reads, 22.7 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 32894877-32894976 [-]
intergenic
Database links

Mature sequence rno-miR-135a-5p

Accession MIMAT0000841
Previous IDsrno-miR-135a
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing3996 reads, 22 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-135a-3p

Accession MIMAT0004732
Previous IDsrno-miR-135a*
Sequence

62 - 

uguagggauggaagccaugaaa

 - 83

Get sequence
Deep sequencing137 reads, 8 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16471176 "Assessment of the microRNA system in salt-sensitive hypertension" Naraba H, Iwai N Hypertens Res. 28:819-826(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).