Stem-loop sequence rno-mir-135a

AccessionMI0000908 (change log)
DescriptionRattus norvegicus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Literature search

23 open access papers mention rno-mir-135a
(67 sentences)

Stem-loop
   a  uaaa     ucua   c            u            -u gua 
5'  ga    uucac    gug uuuauggcuuuu auuccuauguga  c   a
    ||    |||||    ||| |||||||||||| ||||||||||||  |    
3'  cu    aagug    cau aaguaccgaagg uagggauguacu  g   u
   a  -uaa     -uua   a            -            cu aaa 
Get sequence
Deep sequencing
45824 reads, 31.9 reads per million, 323 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 32894877-32894976 [-]
intergenic
Database links

Mature sequence rno-miR-135a-5p

Accession MIMAT0000841
Previous IDsrno-miR-135a
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing43509 reads, 319 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-135a-3p

Accession MIMAT0004732
Previous IDsrno-miR-135a*
Sequence

62 - 

uguagggauggaagccaugaaa

 - 83

Get sequence
Deep sequencing2273 reads, 177 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16471176 "Assessment of the microRNA system in salt-sensitive hypertension" Naraba H, Iwai N Hypertens Res. 28:819-826(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).