Stem-loop sequence rno-mir-134

AccessionMI0000907 (change log)
DescriptionRattus norvegicus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c     gu        u  -a   g    gcgu  a 
5'  agggu  gugacugg ug  cca aggg    gc c
    |||||  |||||||| ||  ||| ||||    || u
3'  uccca  cacugauc ac  ggu uccc    ug u
   c     ac        c  cg   g    -acu  u 
Get sequence
Deep sequencing
6220 reads, 18.8 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133884547-133884619 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-134
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
Database links

Mature sequence rno-miR-134-5p

Accession MIMAT0000840
Previous IDsrno-miR-134
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Deep sequencing5846 reads, 31 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-134-3p

Accession MIMAT0017125
Previous IDsrno-miR-134*
Sequence

47 - 

cugugggccaccuagucaccaa

 - 68

Get sequence
Deep sequencing366 reads, 19 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).