Stem-loop sequence rno-mir-133a

AccessionMI0000906 (change log)
DescriptionRattus norvegicus miR-133a stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -      uuu    a       aa  u  a        gccuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
955815 reads, 1.73e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 2052478-2052564 [-]
antisense
ENSRNOT00000053774 ; Mir3582-201; exon 1
ENSRNOT00000018025 ; Mib1-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-133a
rno-mir-1chr18: 2054933-2055019 [-]
rno-mir-3571chr18: 2054922-2055032 [+]
rno-mir-133achr18: 2052478-2052564 [-]
rno-mir-133cchr18: 2052459-2052576 [+]
Database links

Mature sequence rno-miR-133a-5p

Accession MIMAT0017124
Previous IDsrno-miR-133a*
Sequence

15 - 

agcugguaaaauggaaccaaau

 - 36

Get sequence
Deep sequencing1258 reads, 24 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-133a-3p

Accession MIMAT0000839
Previous IDsrno-miR-133a
Sequence

52 - 

uuugguccccuucaaccagcug

 - 73

Get sequence
Deep sequencing954554 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).