Stem-loop sequence rno-mir-133a

AccessionMI0000906 (change log)
DescriptionRattus norvegicus miR-133a stem-loop
Gene family MIPF0000029; mir-133
Literature search

98 open access papers mention rno-mir-133a
(655 sentences)

Stem-loop
   -      uuu    a       aa  u  a        gccuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
34839834 reads, 2.09e+04 reads per million, 491 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 2052478-2052564 [-]
antisense
ENSRNOT00000053774 ; Mir3582-201; exon 1
ENSRNOT00000018025 ; Mib1-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-133a
rno-mir-1chr18: 2054933-2055019 [-]
rno-mir-3571chr18: 2054922-2055032 [+]
rno-mir-133achr18: 2052478-2052564 [-]
rno-mir-133cchr18: 2052459-2052576 [+]
Database links

Mature sequence rno-miR-133a-5p

Accession MIMAT0017124
Previous IDsrno-miR-133a*
Sequence

15 - 

agcugguaaaauggaaccaaau

 - 36

Get sequence
Deep sequencing45020 reads, 239 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-133a-3p

Accession MIMAT0000839
Previous IDsrno-miR-133a
Sequence

52 - 

uuugguccccuucaaccagcug

 - 73

Get sequence
Deep sequencing34794668 reads, 491 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).