Stem-loop sequence rno-mir-132

AccessionMI0000905 (change log)
DescriptionRattus norvegicus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cc  cccc    -  c a    a         uuc          -g     
5'   gc    gcgu cu c gggc accguggcu   gauuguuacu  uggg 
     ||    |||| || | |||| |||||||||   ||||||||||  ||| a
3'   cg    cgca ga g cccg ugguaccga   cugacaaugg  gcca 
   cu  cacc    c  c c    c         cau          ag     
Get sequence
Deep sequencing
10850 reads, 113 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 62014995-62015095 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-132
rno-mir-212chr10: 62014702-62014812 [+]
rno-mir-132chr10: 62014995-62015095 [+]
Database links

Mature sequence rno-miR-132-5p

Accession MIMAT0017123
Previous IDsrno-miR-132*
Sequence

23 - 

accguggcuuucgauuguuacu

 - 44

Get sequence
Deep sequencing1087 reads, 23 experiments
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-132-3p

Accession MIMAT0000838
Previous IDsrno-miR-132
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Deep sequencing9762 reads, 38 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).