Stem-loop sequence rno-mir-130b

AccessionMI0000904 (change log)
DescriptionRattus norvegicus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         c    ca       cc         a  guggg  u 
5' ggcuug ugga  cucuuuc  uguugcacu cu     cc c
   |||||| ||||  |||||||  ||||||||| ||     ||  
3' ccggac gccu  gggaaag  guaacguga ga     gg u
         u    ac       ua         c  ----a  g 
Get sequence
Deep sequencing
3288 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 88129773-88129854 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-130b
rno-mir-301bchr11: 88129426-88129503 [+]
rno-mir-130bchr11: 88129773-88129854 [+]
Database links

Mature sequence rno-miR-130b-5p

Accession MIMAT0017122
Previous IDsrno-miR-130b*
Sequence

13 - 

acucuuucccuguugcacuacu

 - 34

Get sequence
Deep sequencing323 reads, 27 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-130b-3p

Accession MIMAT0000837
Previous IDsrno-miR-130b
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing2963 reads, 38 experiments
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).