Stem-loop sequence rno-mir-130b

AccessionMI0000904 (change log)
DescriptionRattus norvegicus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

22 open access papers mention rno-mir-130b
(148 sentences)

Stem-loop
         c    ca       cc         a  guggg  u 
5' ggcuug ugga  cucuuuc  uguugcacu cu     cc c
   |||||| ||||  |||||||  ||||||||| ||     ||  
3' ccggac gccu  gggaaag  guaacguga ga     gg u
         u    ac       ua         c  ----a  g 
Get sequence
Deep sequencing
29465 reads, 21.9 reads per million, 474 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 88129773-88129854 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-130b
rno-mir-301bchr11: 88129426-88129503 [+]
rno-mir-130bchr11: 88129773-88129854 [+]
Database links

Mature sequence rno-miR-130b-5p

Accession MIMAT0017122
Previous IDsrno-miR-130b*
Sequence

13 - 

acucuuucccuguugcacuacu

 - 34

Get sequence
Deep sequencing2725 reads, 347 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-130b-3p

Accession MIMAT0000837
Previous IDsrno-miR-130b
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing26732 reads, 473 experiments
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).