Stem-loop sequence rno-mir-130a

AccessionMI0000903 (change log)
DescriptionRattus norvegicus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

30 open access papers mention rno-mir-130a
(137 sentences)

Stem-loop
   u     -u     ga        c      ug  a  guc   a 
5'  gcugc  ggccg  gcucuuuu acauug  cu cu   uac c
    |||||  |||||  |||||||| ||||||  || ||   |||  
3'  ugaug  ccggc  cgggaaaa uguaac  ga ga   aug g
   -     uu     ua        u      gu  c  gcc   u 
Get sequence
Deep sequencing
514756 reads, 429 reads per million, 507 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 72141037-72141124 [-]
sense
ENSRNOT00000009903 ; Smtnl1-201; intron 8
Clustered miRNAs
< 10kb from rno-mir-130a
rno-mir-3590chr3: 72141044-72141117 [+]
rno-mir-130achr3: 72141037-72141124 [-]
Database links

Mature sequence rno-miR-130a-5p

Accession MIMAT0017121
Previous IDsrno-miR-130a*
Sequence

15 - 

gcucuuuucacauugugcuacu

 - 36

Get sequence
Deep sequencing408 reads, 187 experiments
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-130a-3p

Accession MIMAT0000836
Previous IDsrno-miR-130a
Sequence

55 - 

cagugcaauguuaaaagggcau

 - 76

Get sequence
Deep sequencing514348 reads, 507 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).