Stem-loop sequence rno-mir-130a

Accession MI0000903
Description Rattus norvegicus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
u     -u     ga        c      ug  a  guc   a 
 gcugc  ggccg  gcucuuuu acauug  cu cu   uac c
 |||||  |||||  |||||||| ||||||  || ||   |||  
 ugaug  ccggc  cgggaaaa uguaac  ga ga   aug g
-     uu     ua        u      gu  c  gcc   u
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
3: 67949594-67949681 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-130a
rno-mir-3590 3: 67949601-67949674 [+]
rno-mir-130a 3: 67949594-67949681 [-]
Database links

Mature sequence rno-miR-130a-5p

Accession MIMAT0017121
Previous IDs rno-miR-130a*
Sequence

15 -  

gcucuuuucacauugugcuacu

 - 36

Get sequence
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-130a-3p

Accession MIMAT0000836
Previous IDs rno-miR-130a
Sequence

55 -  

cagugcaauguuaaaagggcau

 - 76

Get sequence
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).