Stem-loop sequence rno-mir-129-1

AccessionMI0000902 (change log)
DescriptionRattus norvegicus miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    -       c   cu      g   uu  -  c 
5'  gggu cuuuuug ggu  gggcuu cug  cu cu c
    |||| ||||||| |||  |||||| |||  || ||  
3'  ucua gaaaaac cca  cccgaa gac  ga ga a
   -    u       c   uu      g   -u  u  c 
Get sequence
Deep sequencing
14658 reads, 79.4 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 56301726-56301797 [+]
intergenic
Database links

Mature sequence rno-miR-129-5p

Accession MIMAT0000600
Previous IDsrno-miR-129
Sequence

6 - 

cuuuuugcggucugggcuugc

 - 26

Get sequence
Deep sequencing11552 reads, 32 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-129-1-3p

Accession MIMAT0017120
Previous IDsrno-miR-129-1*
Sequence

49 - 

aagcccuuaccccaaaaag

 - 67

Get sequence
Deep sequencing8879 reads, 32 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).