Stem-loop sequence rno-mir-128-2

Accession MI0000901
Previous IDs rno-mir-128b
Description Rattus norvegicus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop 
u ug       a          aug      aa    g gag 
 g  caguggg aggggggccg   cacugu  gaga u   u
 |  ||||||| ||||||||||   ||||||  |||| |    
 u  gucaucc uuucucuggc   gugaca  cucu g   a
c gu       c          caa      --    g acg
Get sequence
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
8: 116727237-116727320 [-]
sense
ENSRNOT00000066094 ; D3ZCD8_RAT; intron 13
ENSRNOT00000066094 ; D3ZCD8_RAT; intron 13
ENSRNOT00000066094 ; D3ZCD8_RAT; intron 13
ENSRNOT00000064408 ; D3ZK99_RAT; intron 14
ENSRNOT00000064408 ; D3ZK99_RAT; intron 14
ENSRNOT00000064408 ; D3ZK99_RAT; intron 14
ENSRNOT00000037222 ; D4A682_RAT; intron 16
ENSRNOT00000037222 ; D4A682_RAT; intron 16
ENSRNOT00000037222 ; D4A682_RAT; intron 16
ENSRNOT00000011870 ; D3ZS11_RAT; intron 17
ENSRNOT00000042854 ; D3ZQR3_RAT; intron 17
ENSRNOT00000011870 ; D3ZS11_RAT; intron 17
ENSRNOT00000042854 ; D3ZQR3_RAT; intron 17
ENSRNOT00000011870 ; D3ZS11_RAT; intron 17
ENSRNOT00000042854 ; D3ZQR3_RAT; intron 17
Database links

Mature sequence rno-miR-128-2-5p

Accession MIMAT0017119
Previous IDs rno-miR-128-2*
Sequence

15 -  

gggggccgaugcacuguaaga

 - 35

Get sequence
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-128-3p

Accession MIMAT0000834
Previous IDs rno-miR-128a;rno-miR-128
Sequence

52 -  

ucacagugaaccggucucuuu

 - 72

Get sequence
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).