Stem-loop sequence rno-mir-128-2

AccessionMI0000901 (change log)
Previous IDsrno-mir-128b
DescriptionRattus norvegicus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ug       a          aug      aa    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Deep sequencing
84021 reads, 1.15e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 120378945-120379028 [-]
sense
ENSRNOT00000042854 ; Arpp21-201; intron 17
Database links

Mature sequence rno-miR-128-2-5p

Accession MIMAT0017119
Previous IDsrno-miR-128-2*
Sequence

15 - 

gggggccgaugcacuguaaga

 - 35

Get sequence
Deep sequencing28 reads, 7 experiments
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-128-3p

Accession MIMAT0000834
Previous IDsrno-miR-128a;rno-miR-128
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing168538 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).