Stem-loop sequence rno-mir-127

AccessionMI0000899 (change log)
DescriptionRattus norvegicus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

26 open access papers mention rno-mir-127
(399 sentences)

Stem-loop
   -----uuu   ca   ucu      ugcug         g  c      --  a 
5'         gau  cug   ccagcc     aagcucaga gg ucugau  uc g
           |||  |||   ||||||     ||||||||| || ||||||  || a
3'         cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacuacu   aa   --u      -----         g  u      cu  a 
Get sequence
Deep sequencing
34496900 reads, 2.32e+04 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133713430-133713526 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 5
Clustered miRNAs
< 10kb from rno-mir-127
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-127-5p

Accession MIMAT0017117
Previous IDsrno-miR-127*
Sequence

23 - 

cugaagcucagagggcucugauu

 - 45

Get sequence
Deep sequencing76424 reads, 367 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-127-3p

Accession MIMAT0000833
Previous IDsrno-miR-127
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Deep sequencing34420442 reads, 493 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).