Stem-loop sequence rno-mir-127

AccessionMI0000899 (change log)
DescriptionRattus norvegicus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----uuu   ca   ucu      ugcug         g  c      --  a 
5'         gau  cug   ccagcc     aagcucaga gg ucugau  uc g
           |||  |||   ||||||     ||||||||| || ||||||  || a
3'         cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacuacu   aa   --u      -----         g  u      cu  a 
Get sequence
Deep sequencing
2088054 reads, 1.42e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133713430-133713526 [+]
antisense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 5
Clustered miRNAs
< 10kb from rno-mir-127
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-127-5p

Accession MIMAT0017117
Previous IDsrno-miR-127*
Sequence

23 - 

cugaagcucagagggcucugauu

 - 45

Get sequence
Deep sequencing3255 reads, 30 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-127-3p

Accession MIMAT0000833
Previous IDsrno-miR-127
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Deep sequencing2084797 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).