Stem-loop sequence rno-mir-126a

AccessionMI0000898 (change log)
Previous IDsrno-mir-126
DescriptionRattus norvegicus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Literature search

67 open access papers mention rno-mir-126a
(575 sentences)

Stem-loop
   u   a  a           u       c cug   c 
5'  gac gc cauuauuacuu ugguacg g   uga a
    ||| || ||||||||||| ||||||| |   |||  
3'  cug ug guaauaaugag gccaugc c   acu c
   a   g  c           u       u -aa   u 
Get sequence
Deep sequencing
7410115 reads, 5.48e+03 reads per million, 497 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 4042488-4042560 [+]
sense
ENSRNOT00000026318 ; EGFL7-201; intron 7
antisense
ENSRNOT00000053714 ; Mir3567-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-126a
rno-mir-126bchr3: 4042464-4042581 [-]
rno-mir-126achr3: 4042488-4042560 [+]
Database links

Mature sequence rno-miR-126a-5p

Accession MIMAT0000831
Previous IDsrno-miR-126*
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing5665621 reads, 495 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-126a-3p

Accession MIMAT0000832
Previous IDsrno-miR-126
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing1743448 reads, 491 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).