Stem-loop sequence rno-mir-126a

AccessionMI0000898 (change log)
Previous IDsrno-mir-126
DescriptionRattus norvegicus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   a  a           u       c cug   c 
5'  gac gc cauuauuacuu ugguacg g   uga a
    ||| || ||||||||||| ||||||| |   |||  
3'  cug ug guaauaaugag gccaugc c   acu c
   a   g  c           u       u -aa   u 
Get sequence
Deep sequencing
564229 reads, 5.51e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 4042488-4042560 [+]
sense
ENSRNOT00000026318 ; EGFL7-201; intron 7
antisense
ENSRNOT00000053714 ; Mir3567-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-126a
rno-mir-126bchr3: 4042464-4042581 [-]
rno-mir-126achr3: 4042488-4042560 [+]
Database links

Mature sequence rno-miR-126a-5p

Accession MIMAT0000831
Previous IDsrno-miR-126*
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing427022 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-126a-3p

Accession MIMAT0000832
Previous IDsrno-miR-126
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing137130 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).