Stem-loop sequence rno-mir-125b-2

AccessionMI0000897 (change log)
DescriptionRattus norvegicus miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   accaga   uu     uc  ug   c   a        -gg   u 
5'       cuu  ccuag  cc  aga ccu acuuguga   uau u
         |||  |||||  ||  ||| ||| ||||||||   |||  
3'       gag  ggauc  gg  ucu gga ugaacacu   aug u
   ---gga   gc     ca  gu   c   c        aca   a 
Get sequence
Deep sequencing
210696 reads, 2.12e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 16097346-16097433 [+]
antisense
ENSRNOT00000053649 ; Mir3588-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-125b-2
rno-mir-3588chr11: 16097337-16097442 [-]
rno-mir-125b-2chr11: 16097346-16097433 [+]
Database links

Mature sequence rno-miR-125b-5p

Accession MIMAT0000830
Previous IDsrno-miR-125b
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing376185 reads, 39 experiments
Evidence experimental; cloned [1-5], Northern [1,3], SOLiD [6]
Predicted targets

Mature sequence rno-miR-125b-2-3p

Accession MIMAT0026467
Sequence

56 - 

acaagucaggcucuugggaccu

 - 77

Get sequence
Deep sequencing22600 reads, 39 experiments
Evidence experimental; cloned [4], SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).