Stem-loop sequence rno-mir-125b-1

AccessionMI0000896 (change log)
DescriptionRattus norvegicus miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u    uc c u   uc  ug   c           au     c 
5'  gcgc  c c cag  cc  aga ccuaacuugug  guuua c
    ||||  | | |||  ||  ||| |||||||||||  ||||| g
3'  cgug  g g guc  gg  ucu ggauugggcac  uaaau u
   -    cu a c   ga  gu   c           -c     u 
Get sequence
Deep sequencing
192849 reads, 2e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 45798260-45798346 [+]
sense
Database links

Mature sequence rno-miR-125b-5p

Accession MIMAT0000830
Previous IDsrno-miR-125b
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing376185 reads, 39 experiments
Evidence experimental; cloned [1-5], Northern [1,3], SOLiD [6]
Predicted targets

Mature sequence rno-miR-125b-1-3p

Accession MIMAT0004730
Previous IDsrno-miR-125b-3p
Sequence

55 - 

acggguuaggcucuugggagcu

 - 76

Get sequence
Deep sequencing4754 reads, 37 experiments
Evidence experimental; cloned [4], SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).