Stem-loop sequence rno-mir-125a

AccessionMI0000895 (change log)
DescriptionRattus norvegicus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u     c u ug  uc  ug   c    ua        ----  a 
5'  gccgg c c  gg  cc  aga ccuu  accuguga    gg c
    ||||| | |  ||  ||  ||| ||||  ||||||||    ||  
3'  cgguc g g  cc  gg  ucu ggag  uggacacu    cc g
   -     c c gu  ga  gu   u    --        ggga  u 
Get sequence
Deep sequencing
294931 reads, 2.98e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 59704827-59704911 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-125a
rno-mir-99bchr1: 59704216-59704285 [+]
rno-mir-3596cchr1: 59704372-59704488 [-]
rno-let-7echr1: 59704381-59704473 [+]
rno-mir-125achr1: 59704827-59704911 [+]
Database links

Mature sequence rno-miR-125a-5p

Accession MIMAT0000829
Previous IDsrno-miR-125a
Sequence

15 - 

ucccugagacccuuuaaccuguga

 - 38

Get sequence
Deep sequencing294593 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-125a-3p

Accession MIMAT0004729
Sequence

53 - 

acaggugagguucuugggagcc

 - 74

Get sequence
Deep sequencing337 reads, 32 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).