Stem-loop sequence rno-mir-124-1

AccessionMI0000893 (change log)
Previous IDsrno-mir-124a-1
DescriptionRattus norvegicus miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
27323 reads, 245 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 47964298-47964382 [+]
intergenic
Database links

Mature sequence rno-miR-124-5p

Accession MIMAT0004728
Previous IDsrno-miR-124*
Sequence

14 - 

cguguucacagcggaccuugau

 - 35

Get sequence
Deep sequencing744 reads, 7 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-124-3p

Accession MIMAT0000828
Previous IDsrno-miR-124a;rno-miR-124
Sequence

53 - 

uaaggcacgcggugaaugcc

 - 72

Get sequence
Deep sequencing81221 reads, 31 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).