Stem-loop sequence rno-mir-124-3

AccessionMI0000892 (change log)
Previous IDsrno-mir-124a-3
DescriptionRattus norvegicus miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Literature search

86 open access papers mention rno-mir-124-3
(383 sentences)

Stem-loop
   u    -   c    - c        a   ga        uaaug 
5'  gagg gcc cucu g guguucac gcg  ccuugauu     u
    |||| ||| |||| | |||||||| |||  ||||||||      
3'  cucc cgg gaga c cguaagug cgc  ggaauuaa     c
   c    g   a    a -        g   ac        cauau 
Get sequence
Deep sequencing
1257442 reads, 1.19e+03 reads per million, 377 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 176406205-176406291 [+]
intergenic
Database links

Mature sequence rno-miR-124-5p

Accession MIMAT0004728
Previous IDsrno-miR-124*
Sequence

15 - 

cguguucacagcggaccuugau

 - 36

Get sequence
Deep sequencing29153 reads, 132 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-124-3p

Accession MIMAT0000828
Previous IDsrno-miR-124a;rno-miR-124
Sequence

53 - 

uaaggcacgcggugaaugcc

 - 72

Get sequence
Deep sequencing3743265 reads, 376 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).