Stem-loop sequence rno-mir-122

AccessionMI0000891 (change log)
Previous IDsrno-mir-122a
DescriptionRattus norvegicus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c        -    c gg       ca          -   c 
5'  cuuagcag agcu u  aguguga  augguguuug ugu c
    |||||||| |||| |  |||||||  |||||||||| ||| a
3'  ggaucguc ucga a  ucacacu  uaccgcaaac aca a
   c        a    c aa       ac          u   a 
Get sequence
Deep sequencing
280764 reads, 2.51e+03 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 60755285-60755369 [+]
sense
antisense
ENSRNOT00000053725 ; Mir3591-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-122
rno-mir-122bchr18: 60755272-60755380 [-]
rno-mir-122chr18: 60755285-60755369 [+]
Database links

Mature sequence rno-miR-122-5p

Accession MIMAT0000827
Previous IDsrno-miR-122a;rno-miR-122
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Deep sequencing268932 reads, 24 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-122-3p

Accession MIMAT0017116
Previous IDsrno-miR-122*
Sequence

51 - 

aacgccaucaucacacuaa

 - 69

Get sequence
Deep sequencing11832 reads, 10 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).