Stem-loop sequence rno-mir-122

AccessionMI0000891 (change log)
Previous IDsrno-mir-122a
DescriptionRattus norvegicus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

71 open access papers mention rno-mir-122
(694 sentences)

Stem-loop
   c        -    c gg       ca          -   c 
5'  cuuagcag agcu u  aguguga  augguguuug ugu c
    |||||||| |||| |  |||||||  |||||||||| ||| a
3'  ggaucguc ucga a  ucacacu  uaccgcaaac aca a
   c        a    c aa       ac          u   a 
Get sequence
Deep sequencing
1710665 reads, 2.88e+03 reads per million, 316 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 60755285-60755369 [+]
sense
antisense
ENSRNOT00000053725 ; Mir3591-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-122
rno-mir-122bchr18: 60755272-60755380 [-]
rno-mir-122chr18: 60755285-60755369 [+]
Database links

Mature sequence rno-miR-122-5p

Accession MIMAT0000827
Previous IDsrno-miR-122a;rno-miR-122
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Deep sequencing1637194 reads, 311 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-122-3p

Accession MIMAT0017116
Previous IDsrno-miR-122*
Sequence

51 - 

aacgccaucaucacacuaa

 - 69

Get sequence
Deep sequencing73469 reads, 128 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).