Stem-loop sequence rno-mir-107

AccessionMI0000890 (change log)
DescriptionRattus norvegicus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -      c      --a    u  u           c   u   a 
5'  uucucu ugcuuu   agcu cu uacaguguugc uug ggc u
    |||||| ||||||   |||| || ||||||||||| ||| ||| g
3'  gagaga acgaaa   ucgg ga auguuacgacg aac uug g
   c      c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
143933 reads, 1.17e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 253128250-253128336 [-]
sense
ENSRNOT00000067822 ; Pank1-201; intron 5
Database links

Mature sequence rno-miR-107-5p

Accession MIMAT0017115
Previous IDsrno-miR-107*
Sequence

15 - 

agcuucuuuacaguguugccuugu

 - 38

Get sequence
Deep sequencing86 reads, 21 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-107-3p

Accession MIMAT0000826
Previous IDsrno-miR-107
Sequence

52 - 

agcagcauuguacagggcuauca

 - 74

Get sequence
Deep sequencing143847 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).