Stem-loop sequence rno-mir-106b

AccessionMI0000889 (change log)
DescriptionRattus norvegicus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

26 open access papers mention rno-mir-106b
(161 sentences)

Stem-loop
           ga -ua       g       agaua    uc u 
5' ccugcugg  c   aagugcu acagugc     gugg  c c
   ||||||||  |   ||||||| |||||||     ||||  | u
3' ggacgacc  g   uucaugg ugucacg     cauc  g c
           uc ucg       g       ----c    gu u 
Get sequence
Deep sequencing
98688 reads, 19.8 reads per million, 495 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 19307752-19307833 [-]
sense
ENSRNOT00000001825 ; Mcm7-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-106b
rno-mir-106bchr12: 19307752-19307833 [-]
rno-mir-93chr12: 19307543-19307629 [-]
rno-mir-25chr12: 19307340-19307423 [-]
Database links

Mature sequence rno-miR-106b-5p

Accession MIMAT0000825
Previous IDsrno-miR-106b
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing53838 reads, 495 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-106b-3p

Accession MIMAT0004727
Previous IDsrno-miR-106b*
Sequence

52 - 

ccgcacuguggguacuugcugc

 - 73

Get sequence
Deep sequencing44770 reads, 492 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).