|
miRBase |
|
Stem-loop sequence MI0000888 |
|||||
| Accession | MI0000888 | ||||
| ID | rno-mir-103-1 | ||||
| Description | Rattus norvegicus miR-103-1 stem-loop | ||||
| Stem-loop |
u c c -- u u c u g a ucuua ugcc uc ggcu cu uacagugcugc uug u c u ||||| |||| || |||| || ||||||||||| ||| | | agagu acgg ag ucgg ga auguuacgacg aac a g a c u a ua - c - u g u |
||||
| Genome context |
View flanking features |
||||
| Database links |
|
||||
| Gene family |
MIPF0000024; mir-103 |
||||
Mature sequence MIMAT0000824 |
|
| Accession | MIMAT0000824 |
| ID | rno-miR-103 |
| Sequence |
52 - agcagcauuguacagggcuauga - 74 |
| Evidence | experimental; cloned [1-4], Northern [1,3] |
| Predicted targets |
|
References |
|
| 1 |
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
| 3 | |
| 4 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|