miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000888

Accession MI0000888
ID rno-mir-103-1
Description Rattus norvegicus miR-103-1 stem-loop
Stem-loop 
u     c    c  --    u  u           c   u g a 
 ucuua ugcc uc  ggcu cu uacagugcugc uug u c u
 ||||| |||| ||  |||| || ||||||||||| ||| | |  
 agagu acgg ag  ucgg ga auguuacgacg aac a g a
c     u    a  ua    -  c           -   u g u
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
10: 20695027-20695112 [+]
sense
ENSRNOT00000010150 ; NP_001101742.1; intron 5

View flanking features
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000824

Accession MIMAT0000824
ID rno-miR-103
Sequence

52 -  

agcagcauuguacagggcuauga

 - 74

Get sequence
Evidence experimental; cloned [1-4], Northern [1,3]
Predicted targets

References

1
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
"Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).