Stem-loop sequence MI0000887

Accession MI0000887
ID rno-mir-103-2
Description Rattus norvegicus miR-103-2 stem-loop
Stem-loop 
g    c  g      --   u  u           ----    ua 
 ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
 |||| || ||||||  ||| || |||||||||||    ||||  c
 agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
a    c  a      au   -  c           aacu    uu
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
3: 118996602-118996687 [+]
sense
ENSRNOT00000033554 ; Pank2; intron 5

View flanking features
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000824

Accession MIMAT0000824
ID rno-miR-103
Sequence

52 -  

agcagcauuguacagggcuauga

 - 74

Get sequence
Evidence experimental; cloned [1-3], Northern [1-2]
Predicted targets

References

1
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).