Stem-loop sequence rno-mir-103-2

AccessionMI0000887 (change log)
DescriptionRattus norvegicus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

31 open access papers mention rno-mir-103-2
(125 sentences)

Stem-loop
   g    c  g      --   u  u           ----    ua 
5'  ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
    |||| || ||||||  ||| || |||||||||||    ||||  c
3'  agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
   a    c  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
2031389 reads, 1.45e+03 reads per million, 509 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 123833671-123833756 [+]
sense
ENSRNOT00000033554 ; Pank2-201; intron 5
Database links

Mature sequence rno-miR-103-2-5p

Accession MIMAT0017113
Previous IDsrno-miR-103-2*
Sequence

15 - 

agcuucuuuacagugcu

 - 31

Get sequence
Deep sequencing1449 reads, 281 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-103-3p

Accession MIMAT0000824
Previous IDsrno-miR-103
Sequence

52 - 

agcagcauuguacagggcuauga

 - 74

Get sequence
Deep sequencing4059051 reads, 509 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).