Stem-loop sequence rno-mir-101a

Accession MI0000886
Previous IDs rno-mir-101
Description Rattus norvegicus miR-101a stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   cuggc                  a    gucca 
 gcc     ucaguuaucacagugcug ugcu     u
 |||     |||||||||||||||||| ||||      
 cgg     agucaauagugucaugac augg     u
a   uagga                  -    aaauc 
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
5: 121990585-121990659 [-]
sense
ENSRNOT00000053722 ; Mir101a; exon 1
ENSRNOT00000053722 ; Mir101a; exon 1
ENSRNOT00000053722 ; Mir101a; exon 1
Database links

Mature sequence rno-miR-101a-5p

Accession MIMAT0004726
Previous IDs rno-miR-101a*
Sequence

10 - 

ucaguuaucacagugcugaugc

 - 31

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-101a-3p

Accession MIMAT0000823
Previous IDs rno-miR-101;rno-miR-101a
Sequence

47 - 

uacaguacugugauaacugaa

 - 67

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Validated targets
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).