Stem-loop sequence rno-mir-100

AccessionMI0000885 (change log)
DescriptionRattus norvegicus miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       -uu c    a   cg    uc   a      c  ac 
5' ccug   g caca acc  uaga  cga cuugug ug  c
   ||||   | |||| |||  ||||  ||| |||||| ||   
3' ggau   c gugu ugg  aucu  guu gaacac ac  a
       ugu u    a   au    gu   c      -  gu 
Get sequence
Deep sequencing
124204 reads, 1.55e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 45746948-45747027 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-100
rno-mir-100chr8: 45746948-45747027 [+]
rno-mir-3596achr8: 45753254-45753367 [-]
rno-let-7a-2chr8: 45753264-45753359 [+]
Database links

Mature sequence rno-miR-100-5p

Accession MIMAT0000822
Previous IDsrno-miR-100
Sequence

13 - 

aacccguagauccgaacuugug

 - 34

Get sequence
Deep sequencing124076 reads, 39 experiments
Evidence experimental; cloned [1-2], Northern [1], SOLiD [3]
Predicted targets

Mature sequence rno-miR-100-3p

Accession MIMAT0017112
Previous IDsrno-miR-100*
Sequence

48 - 

caagcuugugucuauaggu

 - 66

Get sequence
Deep sequencing128 reads, 23 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).