Stem-loop sequence rno-mir-99b

AccessionMI0000884 (change log)
DescriptionRattus norvegicus miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
303465 reads, 3.34e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 59704216-59704285 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-99b
rno-mir-99bchr1: 59704216-59704285 [+]
rno-mir-3596cchr1: 59704372-59704488 [-]
rno-let-7echr1: 59704381-59704473 [+]
rno-mir-125achr1: 59704827-59704911 [+]
Database links

Mature sequence rno-miR-99b-5p

Accession MIMAT0000821
Previous IDsrno-miR-99b
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing302320 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-99b-3p

Accession MIMAT0004725
Previous IDsrno-miR-99b*
Sequence

45 - 

caagcucgugucuguggguccg

 - 66

Get sequence
Deep sequencing1145 reads, 37 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).