Stem-loop sequence rno-mir-99a

AccessionMI0000883 (change log)
DescriptionRattus norvegicus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cc     g    a         uc   u      g  aag 
5'   cauug caua acccguaga  cga cuugug ug   u
     ||||| |||| |||||||||  ||| |||||| ||    
3'   gugac gugu uggguaucu  gcu gaacac gc   g
   gu     g    c         uu   c      -  cag 
Get sequence
Deep sequencing
126662 reads, 1.57e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 16052153-16052233 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-99a
rno-mir-99achr11: 16052153-16052233 [+]
rno-let-7c-1chr11: 16052873-16052966 [+]
Database links

Mature sequence rno-miR-99a-5p

Accession MIMAT0000820
Previous IDsrno-miR-99a
Sequence

13 - 

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing124103 reads, 39 experiments
Evidence experimental; cloned [1-5], SOLiD [6]
Predicted targets

Mature sequence rno-miR-99a-3p

Accession MIMAT0004724
Previous IDsrno-miR-99a*
Sequence

50 - 

caagcucguuucuaugggucug

 - 71

Get sequence
Deep sequencing2559 reads, 36 experiments
Evidence experimental; cloned [4], SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).