Stem-loop sequence rno-mir-98

AccessionMI0000882 (change log)
DescriptionRattus norvegicus miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

35 open access papers mention rno-mir-98
(254 sentences)

Stem-loop
   c   -      ug   u                 u    ---------      aggg 
5'  ugc acaugc  ggg gagguaguaaguuguau guug         uggggu    a
    ||| ||||||  ||| ||||||||||||||||| ||||         ||||||    u
3'  acg ugugug  ccc uuucaucauucaacaua caau         accccg    u
   u   g      gu   -                 u    agaagaaua      gauu 
Get sequence
Deep sequencing
8413287 reads, 7.51e+03 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 21583875-21583982 [+]
sense
ENSRNOT00000003882 ; Huwe1-201; intron 73
Clustered miRNAs
< 10kb from rno-mir-98
rno-let-7f-2chrX: 21583272-21583354 [+]
rno-mir-98chrX: 21583875-21583982 [+]
Database links

Mature sequence rno-miR-98-5p

Accession MIMAT0000819
Previous IDsrno-miR-98
Sequence

16 - 

ugagguaguaaguuguauuguu

 - 37

Get sequence
Deep sequencing8395697 reads, 514 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-98-3p

Accession MIMAT0017111
Previous IDsrno-miR-98*
Sequence

74 - 

cuauacaacuuacuacuuucc

 - 94

Get sequence
Deep sequencing17587 reads, 474 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).