Stem-loop sequence rno-mir-96

AccessionMI0000881 (change log)
DescriptionRattus norvegicus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

25 open access papers mention rno-mir-96
(125 sentences)

Stem-loop
   c     cca       gg  g  u        a      uu      ---   uc 
5'  cagua   ucugcuu  cc au uuggcacu gcacau  uugcuu   gug  u
    |||||   |||||||  || || |||||||| ||||||  ||||||   |||   
3'  gucgu   gggcgaa  gg ua aaccguga cgugua  aacgag   cgc  c
   c     --c       aa  g  u        -      cu      ucu   cu 
Get sequence
Deep sequencing
23365 reads, 6.97 reads per million, 402 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 57463366-57463471 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-96
rno-mir-3553chr4: 57463572-57463677 [+]
rno-mir-183chr4: 57463569-57463678 [-]
rno-mir-96chr4: 57463366-57463471 [-]
rno-mir-182chr4: 57459773-57459834 [-]
Database links

Mature sequence rno-miR-96-5p

Accession MIMAT0000818
Previous IDsrno-miR-96
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Deep sequencing23316 reads, 402 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-96-3p

Accession MIMAT0017110
Previous IDsrno-miR-96*
Sequence

66 - 

caaucaugugcagugccaauau

 - 87

Get sequence
Deep sequencing30 reads, 26 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).