Stem-loop sequence rno-mir-93

AccessionMI0000880 (change log)
DescriptionRattus norvegicus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

29 open access papers mention rno-mir-93
(112 sentences)

Stem-loop
   a   a         -ca       -     u    g   ug  u 
5'  guc ugggggcuc   aagugcu guucg gcag uag  ca u
    ||| |||||||||   ||||||| ||||| |||| |||  || g
3'  cag acccccgag   uucacga cgagu cguc auc  gu c
   a   g         ccc       u     -    -   ca  c 
Get sequence
Deep sequencing
514855 reads, 348 reads per million, 499 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 19307543-19307629 [-]
sense
ENSRNOT00000001825 ; Mcm7-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-93
rno-mir-106bchr12: 19307752-19307833 [-]
rno-mir-93chr12: 19307543-19307629 [-]
rno-mir-25chr12: 19307340-19307423 [-]
Database links

Mature sequence rno-miR-93-5p

Accession MIMAT0000817
Previous IDsrno-miR-93
Sequence

15 - 

caaagugcuguucgugcagguag

 - 37

Get sequence
Deep sequencing510074 reads, 499 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-93-3p

Accession MIMAT0017109
Previous IDsrno-miR-93*
Sequence

53 - 

acugcugagcuagcacuucccga

 - 75

Get sequence
Deep sequencing4762 reads, 438 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).