Stem-loop sequence rno-mir-92a-2

AccessionMI0000879 (change log)
Previous IDsrno-mir-92-2
DescriptionRattus norvegicus miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

34 open access papers mention rno-mir-92a-2
(178 sentences)

Stem-loop
   u    ---a   a   a     g     u     cau     guguu 
5'  gccc    uuc ucc caggu gggau agugc   uacuu     a
    ||||    ||| ||| ||||| ||||| |||||   |||||      
3'  uggg    aag agg guccg cccug ucacg   augaa     g
   u    agaa   a   a     g     u     -uu     aaaua 
Get sequence
Deep sequencing
4549084 reads, 4.26e+03 reads per million, 509 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 140117249-140117340 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-92a-2
rno-mir-17-2chrX: 140117891-140117968 [-]
rno-mir-20bchrX: 140117518-140117589 [-]
rno-mir-19b-2chrX: 140117379-140117474 [-]
rno-mir-92a-2chrX: 140117249-140117340 [-]
rno-mir-363chrX: 140117098-140117184 [-]
Database links

Mature sequence rno-miR-92a-2-5p

Accession MIMAT0017108
Previous IDsrno-miR-92a-2*
Sequence

16 - 

agguggggauuagugccauuac

 - 37

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-92a-3p

Accession MIMAT0000816
Previous IDsrno-miR-92;rno-miR-92a
Sequence

55 - 

uauugcacuugucccggccug

 - 75

Get sequence
Deep sequencing11459901 reads, 510 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).