Stem-loop sequence rno-mir-92a-1

AccessionMI0000878 (change log)
Previous IDsrno-mir-92-1
DescriptionRattus norvegicus miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

35 open access papers mention rno-mir-92a-1
(180 sentences)

Stem-loop
   ---cu   uac            uu  c           uu 
5'      uuc   acagguugggau  gu gcaaugcugug  u
        |||   ||||||||||||  || |||||||||||   
3'      gag   uguccggcccug  ca cguuaugauau  c
   gguuu   --u            uu  -           gu 
Get sequence
Deep sequencing
6922123 reads, 6.25e+03 reads per million, 511 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 100180586-100180663 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-92a-1
rno-mir-17-1chr15: 100179879-100179962 [+]
rno-mir-18achr15: 100180015-100180110 [+]
rno-mir-19achr15: 100180162-100180243 [+]
rno-mir-20achr15: 100180334-100180418 [+]
rno-mir-19b-1chr15: 100180464-100180550 [+]
rno-mir-92a-1chr15: 100180586-100180663 [+]
Database links

Mature sequence rno-miR-92a-1-5p

Accession MIMAT0017107
Previous IDsrno-miR-92a-1*
Sequence

11 - 

agguugggauuugucgcaaugcu

 - 33

Get sequence
Deep sequencing11299 reads, 469 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-92a-3p

Accession MIMAT0000816
Previous IDsrno-miR-92;rno-miR-92a
Sequence

48 - 

uauugcacuugucccggccug

 - 68

Get sequence
Deep sequencing11459901 reads, 510 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).